Ich habe nicht so viel Erfahrung mit LaTeX und möchte einen Primer in meinem LaTeX-Dokument erstellen. Dieser Primer besteht aus einer Nucleotidsequenz (Buchstaben A, T, G und C), die ich in einem separatem LaTeX-Dokument Primer1.tex gespeichert habe.

Ich habe es mittlerweile irgendwie geschafft, die Beschreibung der Sequenz links neben der Sequenz anzubringen. Außerdem sind 3 Nukleotide eingerahmt. Mein Problem ist, dass mir unmittelbar links von der Sequenz, wie als eine Einleitung des Anfangs, noch ein "5'-" und rechts von der Sequenz, was das Ende beschreibt, ein "-3'" fehlt.

Momentan habe ich diesen Code:

Open in Online-Editor
\begin{filecontents*}{Primer1.tex}
Primer CCACTGGCCACAGCGAAAGTTTGGATGCCCGG 
\end{filecontents*}
\documentclass[a4paper]{report}
\usepackage[english]{babel}
\usepackage [T1] {fontenc}
\usepackage [utf8] {inputenc}
\usepackage{texshade}
\usepackage[usenames,dvipsnames,svgnames]{xcolor}

\begin{document}
\begin{texshade}{Primer1}
    \shadingmode{diverse}
    \setends{1}{1..32}
    \featureslarge
    \feature{top}{1}{1..32}{}{}
    \namesrm\namessl
    \hidenumbering\showruler{top}{1}
    \shownames{left}
    \nameseq{1}{Bcl-xL S73E-Fwd 1:}
    \frameblock{1}{15..17}{Red[1pt]}
    \makeatletter
\end{texshade}

\end{document}

Ich hatte das "5'-" in den Befehl \nameseq geschrieben, wodurch dieses dann dort zu sehen war, wo ich es gerne haben wollte. Allerdings fand ich keinen Weg mein "-3'" rechts von der Sequenz anzubringen.

Vielleicht hat jemand eine Idee, wie ich das Problem lösen könnte.

gefragt 23 Mär, 06:48

Wiechy's gravatar image

Wiechy
712
Akzeptiert: 0%

bearbeitet 23 Mär, 07:07

saputello's gravatar image

saputello
18.4k22352

1

Willkommen auf der TeXwelt!

(23 Mär, 06:51) Clemens

Wirklich niemand, der mir bei dem Problem helfen könnte?

(14 Apr, 14:46) Wiechy
Sei der Erste, der diese Frage beantwortet!
Knebel-Vorschau

Folge dieser Frage

Per E-Mail:

Wenn Du Dich anmeldest, kannst Du Updates hier abonnieren

Per RSS:

Antworten

Antworten und Kommentare

Aktuelle Buch-Infos

LaTeX Cookbook

LaTeX Beginners Guide

Limitierter Rabatt ebook
50% Coupon code tDRet6Y

Markdown-Grundlagen

  • *kursiv* oder _kursiv_
  • **Fett** oder __Fett__
  • Link:[Text](http://url.com/ "Titel")
  • Bild?![alt Text](/path/img.jpg "Titel")
  • nummerierte Liste: 1. Foo 2. Bar
  • zum Hinzufügen ein Zeilenumbruchs füge einfach zwei Leerzeichen an die Stelle ein, an der die neue Zeile sein soll.
  • grundlegende HTML-Tags werden ebenfalls unterstützt

Zugeordnete Themen:

×1
×1
×1

Frage gestellt: 23 Mär, 06:48

Frage wurde angeschaut: 586 Mal

Zuletzt aktualisiert: 14 Apr, 14:47

Verwandte Fragen