DNA Sequenz erstellen
Hallo zusammen,
ich bräuchte bitte noch einmal eure Unterstützung. Ich möchte eine DNA-Sequenz erstellen. Ich habe auch schon eine Möglichkeit im I-Net gefunden. Jedoch bin ich nicht so fit in Latex, um die Möglichkeit an meine Bedürfnisse anzupassen.
Hier der ursprüngliche Code:
\usepackage{xparse}
\usepackage{xcolor,booktabs}
\ExplSyntaxOn
\NewDocumentCommand{\duplexsequence}{mO{}mO{}m}
{
\mbox
{
\renewcommand{\arraystretch}{0}
\jpaul_ds_duplexsequence:nnnnn { #1 } { #2 } { #3 } { #4 } { #5 }
}
}
\cs_new_protected:Nn \jpaul_ds_duplexsequence:nnnnn
{% #1 is the number on the left
% #2 is the optional prefix
% #3 is the number on the right
% #4 is the optional postfix
% #5 is the top sequence
\jpaul_ds_left:nnn { #1 } { #2 } { #3 }
\tl_map_function:nN { #5 } \jpaul_ds_pair:n
\jpaul_ds_right:nnn { #3 } { #4 } { #1 }
}
\cs_new_protected:Nn \jpaul_ds_pair:n
{
\begin{tabular}{@{}c@{}}
\jpaul_ds_top:n { #1 } \\\addlinespace[.6ex]
$|$ \\\addlinespace[.6ex]
\jpaul_ds_bottom:n { #1 }
\end{tabular}
}
\cs_new_protected:Nn \jpaul_ds_top:n
{
\textcolor{top}{#1}
}
\cs_new_protected:Nn \jpaul_ds_bottom:n
{
\textcolor{bottom}
{
\str_case:nn { #1 }
{
{T}{A}
{A}{T}
{C}{G}
{G}{C}
}
}
}
\cs_new_protected:Nn \jpaul_ds_left:nnn
{
\begin{tabular}{@{}r@{}}
\smash{\textcolor{top}{#1\quad#2}}\vphantom{T}\\\addlinespace[.6ex]
\phantom{$|$}\\\addlinespace[.6ex]
\smash{\textcolor{bottom}{#3\quad}}\vphantom{T}
\end{tabular}
}
\cs_new_protected:Nn \jpaul_ds_right:nnn
{
\begin{tabular}{@{}l@{}}
\smash{\textcolor{top}{#2\quad#1}}\vphantom{T}\\\addlinespace[.6ex]
\phantom{$|$}\\\addlinespace[.6ex]
\smash{\textcolor{bottom}{\quad#3}}\vphantom{T}
\end{tabular}
}
\ExplSyntaxOff
\definecolor{top}{RGB}{0,0,0}
\definecolor{bottom}{RGB}{0,102,0}
\begin{document}
\duplexsequence{3$'$}{5$'$}{GGCCTATATCGCTTAACCGCGCACATGGA}
\end{document}
Daraus resultiert folgendes Ergebnis:
![alt text][1]
<a href="http://texwelt.de/wissen/upfiles/dnaseq.jpg">
<img src="http://texwelt.de/wissen/upfiles/dnaseq.jpg" style="width:100%;"/>
</a>
Das ist auch völlig in Ordnung und ich brauche es auch so (1. Bild). Aber darüber hinaus brauche ich das ganze auch so, also mit der komplementären RNA und der Möglichkeit am Ende das 3' und 5' zu kommentieren wie auf dem 2. Bild.
![alt text][2]
<a href="http://texwelt.de/wissen/upfiles/IMG_5569.jpg">
<img src="http://texwelt.de/wissen/upfiles/IMG_5569.jpg" style="width:100%;"/>
</a>
Außerdem brauche ich noch die Möglichkeit 3er Gruppen zu erstellen und den komplementären Strang selber zu erstellen ohne das 3' und 5' Ende oder bei Wunsch mit, so dass es parallel zum Hauptstrang ist (3. Bild).
![alt text][3]
<a href="http://texwelt.de/wissen/upfiles/IMG_5570.jpg">
<img src="http://texwelt.de/wissen/upfiles/IMG_5570.jpg" style="width:100%;"/>
</a>
Es muss auch nicht mit dem genannten Code sein. Bin für jede Alternative offen.
Vielen Dank und viele Grüße
Suku
P.s.: Meine Bilder sind in der Vorschau immer zu groß. Kann ich diese im Vorfeld skalieren, oder passiert das automatisch?
[1]: http://texwelt.de/wissen/upfiles/dnaseq.jpg
[2]: http://texwelt.de/wissen/upfiles/IMG_5569.jpg
[3]: http://texwelt.de/wissen/upfiles/IMG_5570.jpg
