Ich habe nicht so viel Erfahrung mit LaTeX und möchte einen Primer in meinem LaTeX-Dokument erstellen. Dieser Primer besteht aus einer Nucleotidsequenz (Buchstaben A, T, G und C), die ich in einem separatem LaTeX-Dokument Primer1.tex gespeichert habe.

Ich habe es mittlerweile irgendwie geschafft, die Beschreibung der Sequenz links neben der Sequenz anzubringen. Außerdem sind 3 Nukleotide eingerahmt. Mein Problem ist, dass mir unmittelbar links von der Sequenz, wie als eine Einleitung des Anfangs, noch ein "5'-" und rechts von der Sequenz, was das Ende beschreibt, ein "-3'" fehlt.

Momentan habe ich diesen Code:

Open in Online-Editor
\begin{filecontents*}{Primer1.tex}
Primer CCACTGGCCACAGCGAAAGTTTGGATGCCCGG 
\end{filecontents*}
\documentclass[a4paper]{report}
\usepackage[english]{babel}
\usepackage [T1] {fontenc}
\usepackage [utf8] {inputenc}
\usepackage{texshade}
\usepackage[usenames,dvipsnames,svgnames]{xcolor}

\begin{document}
\begin{texshade}{Primer1}
    \shadingmode{diverse}
    \setends{1}{1..32}
    \featureslarge
    \feature{top}{1}{1..32}{}{}
    \namesrm\namessl
    \hidenumbering\showruler{top}{1}
    \shownames{left}
    \nameseq{1}{Bcl-xL S73E-Fwd 1:}
    \frameblock{1}{15..17}{Red[1pt]}
    \makeatletter
\end{texshade}

\end{document}

Ich hatte das "5'-" in den Befehl \nameseq geschrieben, wodurch dieses dann dort zu sehen war, wo ich es gerne haben wollte. Allerdings fand ich keinen Weg mein "-3'" rechts von der Sequenz anzubringen.

Vielleicht hat jemand eine Idee, wie ich das Problem lösen könnte.

gefragt 23 Mär '16, 11:48

Wiechy's gravatar image

Wiechy
7126
Akzeptiert-Rate: 0%

bearbeitet 23 Mär '16, 12:07

saputello's gravatar image

saputello
10.8k104064

1

Willkommen auf der TeXwelt!

(23 Mär '16, 11:51) cgnieder

Wirklich niemand, der mir bei dem Problem helfen könnte?

(14 Apr '16, 20:46) Wiechy
Das erste sein, diese Frage zu beantworten!
Vorschau umschalten

Folgen dieser Frage

Per E-Mail:

Wenn sie sich anmelden, kommen Sie für alle Updates hier in Frage

Per RSS:

Antworten

Antworten und Kommentare

Markdown-Grundlagen

  • *kursiv* oder _kursiv_
  • **Fett** oder __Fett__
  • Link:[Text](http://url.com/ "Titel")
  • Bild?![alt Text](/path/img.jpg "Titel")
  • nummerierte Liste: 1. Foo 2. Bar
  • zum Hinzufügen ein Zeilenumbruchs fügen Sie einfach zwei Leerzeichen an die Stelle an der die neue Linie sein soll.
  • grundlegende HTML-Tags werden ebenfalls unterstützt

Frage-Themen:

×1
×1
×1

gestellte Frage: 23 Mär '16, 11:48

Frage wurde gesehen: 1,821 Mal

zuletzt geändert: 14 Apr '16, 20:47

verwandte Fragen